After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек RPL10 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human RPL10 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_006013.3
Размер кДНК:645bp
Описание кДНК:Full length Clone DNA of Homo sapiens ribosomal protein L10.
Синоним гена:QM, L10, NOV, AUTSX5, DXS648, DXS648E
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек RPL10 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек RPL10 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG16153-ACGRBS15400
Человек RPL10 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG16153-ACRRBS15400
Человек RPL10 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG16153-ANGRBS15400
Человек RPL10 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG16153-ANRRBS15400
Человек RPL10 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG16153-CFRBS13340
Человек RPL10 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG16153-CHRBS13340
Человек RPL10 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG16153-CMRBS13340
Человек RPL10 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG16153-CYRBS13340
Человек RPL10 Джин клон кДНК в вектор клонированияHG16153-GRBS5130
Человек RPL10 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG16153-NFRBS13340
Человек RPL10 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG16153-NHRBS13340
Человек RPL10 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG16153-NMRBS13340
Человек RPL10 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG16153-NYRBS13340
Человек RPL10 Джин ORF экспрессии кДНК клона плазмидыHG16153-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG16153-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».