After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек RPE / RPE2-1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human RPE Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC005148
Размер кДНК:687bp
Описание кДНК:Full length Clone DNA of Homo sapiens ribulose-5-phosphate-3-epimerase.
Синоним гена:HUSSY-17, MGC2636, RPE2-1, RPE
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек RPE / RPE2-1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек RPE / RPE2-1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14238-ACGRBS15400
Человек RPE / RPE2-1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14238-ACRRBS15400
Человек RPE / RPE2-1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14238-CFRBS13340
Человек RPE / RPE2-1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14238-CHRBS13340
Человек RPE / RPE2-1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14238-CMRBS13340
Человек RPE / RPE2-1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14238-CYRBS13340
Человек RPE / RPE2-1 Джин клон кДНК в вектор клонированияHG14238-GRBS5130
Человек RPE / RPE2-1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14238-NFRBS13340
Человек RPE / RPE2-1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14238-NHRBS13340
Человек RPE / RPE2-1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14238-NMRBS13340
Человек RPE / RPE2-1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14238-NYRBS13340
Человек RPE / RPE2-1 Джин ORF экспрессии кДНК клона плазмидыHG14238-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

The "ribulose phosphate binding" superfamily defined by the Structural Classification of Proteins (SCOP) database is considered the result of divergent evolution from a common (beta/alpha)(8)-barrel ancestor. The superfamily includes d-ribulose 5-phosphate 3-epimerase (RPE), orotidine 5'-monophosphate decarboxylase (OMPDC), and 3-keto-l-gulonate 6-phosphate decarboxylase (KGPDC). Replication of the human genome requires the activation of thousands of replicons distributed along each one of the chromosomes. Each replicon contains an initiation, or origin, site, at which DNA synthesis begins. In enzymology, a L-ribulose-5-phosphate 3-epimerase is an enzyme that catalyzes the chemical reaction L-ribulose 5-phosphate to L-xylulose 5-phosphate. Hence, RPE has one substrate, L-ribulose 5-phosphate, and one product, L-xylulose 5-phosphate. RPE belongs to the family of isomerases, specifically those racemases and epimerases acting on carbohydrates and derivatives. The systematic name of this enzyme class is L-ribulose-5-phosphate 3-epimerase. Other names in common use include L-xylulose 5-phosphate 3-epimerase, UlaE, and SgaU.

Ссылки
  • Yew WS, et al., 2002,  J. Bacteriol. 184 (1): 302-6.
  • Shimaoka, M. et al., 2005, Biosci Biotechnol Biochem  69 (7):1248-55.
  • Salinero,KK. et al., 2009,  BMC Genomics 10 :351.
  • Size / Price
    Каталог: HG14238-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».