Быстрый заказ

Человек RPE / RPE2-1 Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек RPE Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:BC005148
    Размер кДНК:687bp
    Описание кДНК:Full length Clone DNA of Homo sapiens ribulose-5-phosphate-3-epimerase.
    Синоним гена:HUSSY-17, MGC2636, RPE2-1, RPE
    Виды:Human
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with RPE qPCR primers for gene expression analysis, HP102888 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Человек RPE / RPE2-1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Человек RPE / RPE2-1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14238-ACGRBS15400
    Человек RPE / RPE2-1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14238-ACRRBS15400
    Человек RPE / RPE2-1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14238-CFRBS13340
    Человек RPE / RPE2-1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14238-CHRBS13340
    Человек RPE / RPE2-1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14238-CMRBS13340
    Человек RPE / RPE2-1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14238-CYRBS13340
    Человек RPE / RPE2-1 Джин клон кДНК в вектор клонированияHG14238-GRBS5130
    Человек RPE / RPE2-1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14238-NFRBS13340
    Человек RPE / RPE2-1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14238-NHRBS13340
    Человек RPE / RPE2-1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14238-NMRBS13340
    Человек RPE / RPE2-1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14238-NYRBS13340
    Человек RPE / RPE2-1 Джин ORF экспрессии кДНК клона плазмидыHG14238-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    The "ribulose phosphate binding" superfamily defined by the Structural Classification of Proteins (SCOP) database is considered the result of divergent evolution from a common (beta/alpha)(8)-barrel ancestor. The superfamily includes d-ribulose 5-phosphate 3-epimerase (RPE), orotidine 5'-monophosphate decarboxylase (OMPDC), and 3-keto-l-gulonate 6-phosphate decarboxylase (KGPDC). Replication of the human genome requires the activation of thousands of replicons distributed along each one of the chromosomes. Each replicon contains an initiation, or origin, site, at which DNA synthesis begins. In enzymology, a L-ribulose-5-phosphate 3-epimerase is an enzyme that catalyzes the chemical reaction L-ribulose 5-phosphate to L-xylulose 5-phosphate. Hence, RPE has one substrate, L-ribulose 5-phosphate, and one product, L-xylulose 5-phosphate. RPE belongs to the family of isomerases, specifically those racemases and epimerases acting on carbohydrates and derivatives. The systematic name of this enzyme class is L-ribulose-5-phosphate 3-epimerase. Other names in common use include L-xylulose 5-phosphate 3-epimerase, UlaE, and SgaU.

    Ссылки
  • Yew WS, et al., 2002,  J. Bacteriol. 184 (1): 302-6.
  • Shimaoka, M. et al., 2005, Biosci Biotechnol Biochem  69 (7):1248-55.
  • Salinero,KK. et al., 2009,  BMC Genomics 10 :351.
  • Size / Price
    Каталог: HG14238-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».