RHOJ cDNA ORF Clone, Human, untagged

Price:
Size:
Number:

RHOJ cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
645 bp
Description
Full length Clone DNA of Human ras homolog family member J.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

RHOJ cDNA ORF Clone, Human, untagged: Alternative Names

ARHJ cDNA ORF Clone, Human; RASL7B cDNA ORF Clone, Human; TC10B cDNA ORF Clone, Human; TCL cDNA ORF Clone, Human

RHOJ Background Information

Full Name
ras homolog family member J
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait