After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек RHEB/RHEB2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human RHEB Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_005614.3
Размер кДНК:555bp
Описание кДНК:Full length Clone DNA of Homo sapiens Ras homolog enriched in brain with N terminal His tag.
Синоним гена:RHEB2, MGC111559, RHEB
Виды:Human
переносчик:pCMV3-SP-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек RHEB/RHEB2 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек RHEB/RHEB2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11382-ACGRBS15400
Человек RHEB/RHEB2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11382-ACRRBS15400
Человек RHEB/RHEB2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11382-CFRBS13340
Человек RHEB/RHEB2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11382-CHRBS13340
Человек RHEB/RHEB2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11382-CMRBS13340
Человек RHEB/RHEB2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11382-CYRBS13340
Человек RHEB/RHEB2 Джин клон кДНК в вектор клонированияHG11382-MRBS5130
Человек RHEB/RHEB2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11382-M-FRBS13340
Человек RHEB/RHEB2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11382-NFRBS13340
Человек RHEB/RHEB2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11382-NHRBS13340
Человек RHEB/RHEB2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11382-NMRBS13340
Человек RHEB/RHEB2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11382-NYRBS13340
Человек RHEB/RHEB2 Джин ORF экспрессии кДНК клона плазмидыHG11382-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

RHEB is a recently discovered member of the Ras superfamily that may be involved in neural plasticity. This function is novel and not typically associated with the Ras proteins. RHEB gene is a member of the small GTPase superfamily and encodes a lipid-anchored, cell membrane protein with five repeats of the RAS-related GTP-binding region. RHEB is vital in regulation of growth and cell cycle progression due to its role in the insulin / TOR / S6K signaling pathway. The protein has GTPase activity and shuttles between a GDP-bound form and a GTP-bound form, and farnesylation of RHEB is required for this activity. Three pseudogenes have been mapped, two on chromosome 10 and one on chromosome 22.

Ссылки
  • Karbowniczek, et al. (2004) Regulation of B-Raf kinase activity by tuberin and Rheb is mammalian target of rapamycin (mTOR)-independent. J Biol Chem. 279(29):29930-7.
  • Long, et al. (2005) Rheb binds and regulates the mTOR kinase. Curr Biol. 15(8):702-13.
  • Mizuki N, et al. (1996) Isolation of cDNA and genomic clones of a human Ras-related GTP-binding protein gene and its chromosomal localization to the long arm of chromosome 7, 7q36. Genomics. 34(1):114-8.
  • Size / Price
    Каталог: HG11382-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».