Быстрый заказ

Человек RGS5 / Regulator of G-protein signaling 5 Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек RGS5 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:BC030059
    Размер кДНК:546bp
    Описание кДНК:Full length Clone DNA of Homo sapiens regulator of G-protein signaling 5 DNA.
    Синоним гена:MST092, MST106, MST129, MSTP032, MSTP092, MSTP106, MSTP129
    Виды:Human
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with RGS5 qPCR primers for gene expression analysis, HP103860 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Человек RGS5 / Regulator of G-protein signaling 5 Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Человек RGS5 / Regulator of G-protein signaling 5 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15234-ACGRBS15400
    Человек RGS5 / Regulator of G-protein signaling 5 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15234-ACRRBS15400
    Человек RGS5 / Regulator of G-protein signaling 5 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15234-ANGRBS15400
    Человек RGS5 / Regulator of G-protein signaling 5 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15234-ANRRBS15400
    Человек RGS5 / Regulator of G-protein signaling 5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15234-CFRBS13340
    Человек RGS5 / Regulator of G-protein signaling 5 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15234-CHRBS13340
    Человек RGS5 / Regulator of G-protein signaling 5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15234-CMRBS13340
    Человек RGS5 / Regulator of G-protein signaling 5 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15234-CYRBS13340
    Человек RGS5 / Regulator of G-protein signaling 5 Джин клон кДНК в вектор клонированияHG15234-GRBS5130
    Человек RGS5 / Regulator of G-protein signaling 5 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15234-NFRBS13340
    Человек RGS5 / Regulator of G-protein signaling 5 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15234-NHRBS13340
    Человек RGS5 / Regulator of G-protein signaling 5 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15234-NMRBS13340
    Человек RGS5 / Regulator of G-protein signaling 5 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15234-NYRBS13340
    Человек RGS5 / Regulator of G-protein signaling 5 Джин ORF экспрессии кДНК клона плазмидыHG15234-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».