After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек RGMA Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human RGMA Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_020211
Размер кДНК:1227bp
Описание кДНК:Full length Clone DNA of Homo sapiens RGM domain family, member A with N terminal HA tag.
Синоним гена:RGM
Виды:Human
переносчик:pCMV3-SP-N-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек RGMA Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Человек RGMA Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12086-ACGRBS15396
Человек RGMA Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12086-ACRRBS15396
Человек RGMA Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12086-CFRBS13343
Человек RGMA Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12086-CHRBS13343
Человек RGMA Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12086-CMRBS13343
Человек RGMA Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12086-CYRBS13343
Человек RGMA Джин клон кДНК в вектор клонированияHG12086-GRBS5132
Человек RGMA Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12086-NFRBS13343
Человек RGMA Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12086-NHRBS13343
Человек RGMA Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12086-NMRBS13343
Человек RGMA Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12086-NYRBS13343
Человек RGMA Джин ORF экспрессии кДНК клона плазмидыHG12086-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

RGMa, also known as RGM domain family, member A, belongs to the RGM (repulsive guidance molecule) family whose members are membrane-associated glycoprotein. RGMa is a glycosylphosphatidylinositol-anchored glycoprotein that functions as an axon guidance protein in the developing and adult central nervous system. It helps guide Retinal Ganglion Cell (RGC) axons to the tectum in the midbrain. RGMa has been implicated to play an important role in the developing brain and in the scar tissue that forms after a brain injury. This protein may also function as a tumor suppressor in some cancers.

Ссылки
  • Severyn CJ, et al. (2009). Molecular biology, genetics and biochemistry of the repulsive guidance molecule family. Biochem J. 422 (3): 393-403.
  • Monnier PP, et al. (2002) RGM is a repulsive guidance molecule for retinal axons. Nature. 419: 392-5.
  • Matsunaga E, et al. (2004) RGM and its receptor neogenin regulate neuronal survival. Nature Cell Biology. 6: 749-55.
  • Size / Price
    Каталог: HG12086-NY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».