After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек RGMA Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human RGMA Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_020211
Размер кДНК:1227bp
Описание кДНК:Full length Clone DNA of Homo sapiens RGM domain family, member A with N terminal Flag tag.
Синоним гена:RGM
Виды:Human
переносчик:pCMV3-SP-N-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек RGMA Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Человек RGMA Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12086-ACGRBS15400
Человек RGMA Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12086-ACRRBS15400
Человек RGMA Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12086-CFRBS13340
Человек RGMA Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12086-CHRBS13340
Человек RGMA Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12086-CMRBS13340
Человек RGMA Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12086-CYRBS13340
Человек RGMA Джин клон кДНК в вектор клонированияHG12086-GRBS5130
Человек RGMA Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12086-NFRBS13340
Человек RGMA Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12086-NHRBS13340
Человек RGMA Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12086-NMRBS13340
Человек RGMA Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12086-NYRBS13340
Человек RGMA Джин ORF экспрессии кДНК клона плазмидыHG12086-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

RGMa, also known as RGM domain family, member A, belongs to the RGM (repulsive guidance molecule) family whose members are membrane-associated glycoprotein. RGMa is a glycosylphosphatidylinositol-anchored glycoprotein that functions as an axon guidance protein in the developing and adult central nervous system. It helps guide Retinal Ganglion Cell (RGC) axons to the tectum in the midbrain. RGMa has been implicated to play an important role in the developing brain and in the scar tissue that forms after a brain injury. This protein may also function as a tumor suppressor in some cancers.

Ссылки
  • Severyn CJ, et al. (2009). Molecular biology, genetics and biochemistry of the repulsive guidance molecule family. Biochem J. 422 (3): 393-403.
  • Monnier PP, et al. (2002) RGM is a repulsive guidance molecule for retinal axons. Nature. 419: 392-5.
  • Matsunaga E, et al. (2004) RGM and its receptor neogenin regulate neuronal survival. Nature Cell Biology. 6: 749-55.
  • Size / Price
    Каталог: HG12086-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».