Renin cDNA ORF Clone, Human, C-DDK (Flag®) tag

Price:
Size:
Number:

Renin cDNA ORF Clone, Human, C-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1221 bp
Description
Full length Clone DNA of Human rennin with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Renin cDNA ORF Clone, Human, C-DDK (Flag®) tag: Alternative Names

FLJ10761 cDNA ORF Clone, Human; HNFJ2 cDNA ORF Clone, Human; REN cDNA ORF Clone, Human

Renin Background Information

Renin-1, also known as Ren-1, Angiotensinogenase and Kidney renin, is a member of thepeptidase A1 family. Renin-1 is synthesized by the juxtaglomerular cells of the kidney in response to decreased blood pressure and sodium concentration. androgen and thyroid hormones influence levels of Renin-1 in mouse submandibular gland (SMG) primarily by regulating the amount of Renin-1 mRNA available for translation. Renin-1 is a highly specific endopeptidase, whose only known function is to generate angiotensin I from angiotensinogen in the plasma, initiating a cascade of reactions that produce an elevation of blood pressure and increased sodium retention by the kidney. It is expressed at relatively low levels in mouse SMG and kidney. Ren-2 is expressed at high levels in the mouse SMG and at very low levels, if at all, in the kidney. Ren-1 and Ren-2 are closely linked on mouse chromosome 1, show extensive homology in coding and noncoding regions and provide a model for studying the regulation of gene expression.
Full Name
renin
References
  • McKeon F.D., et al.,(1986), Homologies in both primary and secondary structure between nuclear envelope and intermediate filament proteins. Nature 319:463-468.
  • Fisher D.Z., et al., (1986), cDNA sequencing of nuclear lamins A and C reveals primary and secondary structural homology to intermediate filament proteins.Proc. Natl. Acad. Sci. U.S.A. 83:6450-6454.
  • Sylvius N., et al.,(2005), In vivo and in vitro examination of the functional significances of novel lamin gene mutations in heart failure patients.J. Med. Genet. 42:639-647.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait