Быстрый заказ

Человек Renin Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human REN Информация о продукте «Клон cDNA»
Размер кДНК:1221bp
Описание кДНК:Full length Clone DNA of Homo sapiens rennin with C terminal Flag tag.
Синоним гена:FLJ10761
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек Renin Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Человек Renin Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10969-ACGRBS15400
Человек Renin Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10969-ACRRBS15400
Человек Renin Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10969-CFRBS13340
Человек Renin Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10969-CHRBS13340
Человек Renin Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10969-CMRBS13340
Человек Renin Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10969-CYRBS13340
Человек Renin Джин клон кДНК в вектор клонированияHG10969-MRBS5130
Человек Renin Джин ORF экспрессии кДНК клона плазмидыHG10969-M-NRBS13340
Человек Renin Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10969-NFRBS13340
Человек Renin Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10969-NHRBS13340
Человек Renin Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10969-NMRBS13340
Человек Renin Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10969-NYRBS13340
Человек Renin Джин ORF экспрессии кДНК клона плазмидыHG10969-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Mouse Renin-1, also known as Ren-1, Angiotensinogenase and Kidney renin, is a member of the peptidase A1 family. Renin-1 is synthesized by the juxtaglomerular cells of the kidney in response to decreased blood pressure and sodium concentration. androgen and thyroid hormones influence levels of Renin-1 in mouse submandibular gland (SMG) primarily by regulating the amount of Renin-1 mRNA available for translation. Renin-1 is a highly specific endopeptidase, whose only known function is to generate angiotensin I from angiotensinogen in the plasma, initiating a cascade of reactions that produce an elevation of blood pressure and increased sodium retention by the kidney. It is expressed at relatively low levels in mouse SMG and kidney. Ren-2 is expressed at high levels in the mouse SMG and at very low levels, if at all, in the kidney. Ren-1 and Ren-2 are closely linked on mouse chromosome 1, show extensive homology in coding and noncoding regions and provide a model for studying the regulation of gene expression.

Size / Price
Каталог: HG10969-CF
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.