After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек RELA / Transcription factor p65 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human RELA Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_021975
Размер кДНК:1656bp
Описание кДНК:Full length Clone DNA of Homo sapiens v-rel reticuloendotheliosis viral oncogene homolog A (avian) with C terminal His tag.
Синоним гена:p65
Виды:Human
переносчик:pCMV3-C-His
Plasmid:pCMV3-RELA-His
Участок рестрикции:KpnI + XbaI (6kb + 1.7kb)
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human RELA Gene Plasmid Map
Human RELA / Transcription factor p65 / NFkB p65 ORF mammalian expression plasmid, C-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек RELA / Transcription factor p65 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек RELA / Transcription factor p65 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12054-ACGRBS16760
Человек RELA / Transcription factor p65 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12054-ACRRBS16760
Человек RELA / Transcription factor p65 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG12054-ANGRBS16760
Человек RELA / Transcription factor p65 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG12054-ANRRBS16760
Человек RELA / Transcription factor p65 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12054-CFRBS14710
Человек RELA / Transcription factor p65 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12054-CHRBS14710
Человек RELA / Transcription factor p65 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12054-CMRBS14710
Человек RELA / Transcription factor p65 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12054-CYRBS14710
Человек RELA / Transcription factor p65 Джин клон кДНК в вектор клонированияHG12054-GRBS5130
Человек RELA / Transcription factor p65 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12054-NFRBS14710
Человек RELA / Transcription factor p65 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12054-NHRBS14710
Человек RELA / Transcription factor p65 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12054-NMRBS14710
Человек RELA / Transcription factor p65 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12054-NYRBS14710
Человек RELA / Transcription factor p65 Джин ORF экспрессии кДНК клона плазмидыHG12054-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

RELA (v-rel reticuloendotheliosis viral oncogene homolog A), also known as Nuclear factor NF-kappa-B p65 subunit, or Transcription factor p65, is a transcription factor expressed in growth plate chondrocytes where it facilitates chondrogenesis. The v-rel avian reticuloendotheliosis viral oncogene homolog A (RELA) gene encodes the major component of the NF-?B complex. NF-kappaB is a generic name for an evolutionarily conserved transcription-factor system that contributes to the mounting of an effective immune response but is also involved in the regulation of cell proliferation, development, and apoptosis. The implication of NF-kappaB in central biological processes and its extraordinary connectivity to other signaling pathways raise a need for highly controlled regulation of NF-kappaB activity at several levels. The mammalian Rel/NF-kappaB family of transcription factors, including RelA, c-Rel, RelB, NF-kappaB1 (p50 and its precursor p105), and NF-kappaB2 (p52 and its precursor p100), plays a central role in the immune system by regulating several processes ranging from the development and survival of lymphocytes and lymphoid organs to the control of immune responses and malignant transformation.

Ссылки
  • Hashimoto R, et al. (2011) Variants of the RELA gene are associated with schizophrenia and their startle responses. Neuropsychopharmacology. 36(9): 1921-31.
  • Vallabhapurapu S, et al. (2009) Regulation and function of NF-kappaB transcription factors in the immune system. Annu Rev Immunol. 27: 693-733.
  • Schmitz ML, et al. (2004) NF-kappaB: a multifaceted transcription factor regulated at several levels. Chembiochem. 5(10): 1348-58.
  • Size / Price
    Каталог: HG12054-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
    • Human RELA / Transcription factor p65 / NFkB p65 ORF mammalian expression plasmid, C-His tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».