Быстрый заказ

Человек REL Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human REL Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC117191
Размер кДНК:1764bp
Описание кДНК:Full length Clone DNA of Homo sapiens v-rel reticuloendotheliosis viral oncogene homolog (avian) with N terminal Flag tag.
Синоним гена:C-Rel, REL
Виды:Human
переносчик:pCMV3-N-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек REL Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Человек REL Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13986-ACGRBS16760
Человек REL Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13986-ACRRBS16760
Человек REL Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG13986-ANGRBS16760
Человек REL Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG13986-ANRRBS16760
Человек REL Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13986-CFRBS14710
Человек REL Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13986-CHRBS14710
Человек REL Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13986-CMRBS14710
Человек REL Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13986-CYRBS14710
Человек REL Джин клон кДНК в вектор клонированияHG13986-GRBS5130
Человек REL Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13986-NFRBS14710
Человек REL Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13986-NHRBS14710
Человек REL Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13986-NMRBS14710
Человек REL Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13986-NYRBS14710
Человек REL Джин ORF экспрессии кДНК клона плазмидыHG13986-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».