Быстрый заказ

Человек REG4 Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек REG4 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_032044.2
    Размер кДНК:477bp
    Описание кДНК:Full length Clone DNA of Homo sapiens regenerating islet-derived family, member 4.
    Синоним гена:GISP, RELP, REG-IV, REG4
    Виды:Human
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with REG4 qPCR primers for gene expression analysis, HP101092 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Человек REG4 Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Человек REG4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11186-ACGRBS15400
    Человек REG4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11186-ACRRBS15400
    Человек REG4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11186-CFRBS13340
    Человек REG4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11186-CHRBS13340
    Человек REG4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11186-CMRBS13340
    Человек REG4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11186-CYRBS13340
    Человек REG4 Джин клон кДНК в вектор клонированияHG11186-MRBS5130
    Человек REG4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11186-M-FRBS13340
    Человек REG4 Джин ORF экспрессии кДНК клона плазмидыHG11186-M-NRBS13340
    Человек REG4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11186-NFRBS13340
    Человек REG4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11186-NHRBS13340
    Человек REG4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11186-NMRBS13340
    Человек REG4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11186-NYRBS13340
    Человек REG4 Джин ORF экспрессии кДНК клона плазмидыHG11186-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    Regenerating islet-derived protein 4, also known as REG-like protein, REG4, GISP and RELP, a member of the regenerating gene family belonging to the calcium (C-type) dependent lectin superfamily, has been found to be involved in malignancy in several different organs including the stomach, colorectum, pancreas and prostate. It is highly expressed in the gastrointestinal tract and markedly up-regulated in colon adenocarcinoma, pancreatic cancer, gastric adenocarcinoma, and inflammatory bowel disease. Expression of the Reg4 in different cell types has been associated with regeneration, cell growth and cell survival, cell adhesion and resistance to apoptosis. REG4 protein overexpression is associated with an unfavorable response to preoperative chemoradiotherapy and may be used as a predictive biomarker clinically. REG4 may play an important role in the development and progression of colorectal cancer, as well as in intestinal morphogenesis and epithelium restitution.

    Ссылки
  • Li FY, et al. (2010) RegIV expression showing specificity to gastrointestinal tract and its potential role in diagnosing digestive tract neuroendocrine tumor. J Zhejiang Univ Sci B. 11(4):258-66.
  • Rafa L, et al. (2010) REG4 acts as a mitogenic, motility and pro-invasive factor for colon cancer cells. Int J Oncol. 36(3): 689-98.
  • Hu G, et al. (2010) Purification of a bioactive recombinant human Reg IV expressed in Escherichia coli. Protein Expr Purif. 69(2): 186-90.
  • Size / Price
    Каталог: HG11186-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».