Reg3A cDNA ORF Clone, Human, C-Myc tag

1/1
Price:
Size:
Number:

Reg3A cDNA ORF Clone, Human, C-Myc tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
573 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human regenerating islet-derived 3 alpha with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI(6kb+0.57kb)
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Reg3A cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Reg3A cDNA ORF Clone, Human, C-Myc tag: Validated Images

Reg3A cDNA ORF Clone, Human, C-Myc tag: Alternative Names

HIP cDNA ORF Clone, Human; HIP/PAP cDNA ORF Clone, Human; INGAP cDNA ORF Clone, Human; PAP cDNA ORF Clone, Human; PAP-H cDNA ORF Clone, Human; PAP1 cDNA ORF Clone, Human; PBCGF cDNA ORF Clone, Human; REG-III cDNA ORF Clone, Human; REG3 cDNA ORF Clone, Human; REG3A cDNA ORF Clone, Human; REG3V cDNA ORF Clone, Human

Reg3A Background Information

Regenerating islet-derived protein 3-alpha, also known as Regenerating islet-derived protein III-alpha, REG-3-alpha, REG3A, and HIP, is secreted protein which contains one C-type lectin domain. REG3A is constitutively expressed in intestine, and is a pancreatic secretory protein that may be involved in cell proliferation or differentiation. It is overexpressed during the acute phase of pancreatitis and in some patients with chronic pancreatitis. REG3A and REG1A proteins are both involved in liver and pancreatic regeneration and proliferation. REG3A is also a stress protein involved in the control of bacterial proliferation. REG3A is down-regulated in most primary human gastric cancer cells, and might be useful in the diagnosis of gastric cancer. Additionally, REG3A is a target of beta-catenin signaling in Huh7 hepatoma cells. The REG1A and REG3A are downstream targets of the Wnt pathway during liver tumorigenesis.
Full Name
regenerating family member 3 alpha
References
  • Cavard C, et al. (2006) Overexpression of regenerating islet-derived 1 alpha and 3 alpha genes in human primary liver tumors with beta-catenin mutations. Oncogene. 25(4): 599-608.
  • Choi B, et al. (2007) Downregulation of regenerating islet-derived 3 alpha (REG3A) in primary human gastric adenocarcinomas. Exp Mol Med. 39(6): 796-804.
Add to Cart Successfully Add to Cart Failed