Быстрый заказ

Человек REG3A Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек REG3A Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_002580.1
    Размер кДНК:528bp
    Описание кДНК:Full length Clone DNA of Homo sapiens regenerating islet-derived 3 alpha with N terminal Flag tag.
    Синоним гена:HIP, PAP, PAP1, REG3, PAP-H, PBCGF, REG-III, REG3A
    Виды:Human
    переносчик:pCMV3-N-FLAG
    Plasmid:
    Участок рестрикции:
    Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with REG3A qPCR primers for gene expression analysis, HP101179 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Человек REG3A Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
    Человек REG3A Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11235-ACGRBS15400
    Человек REG3A Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11235-ACRRBS15400
    Человек REG3A Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG11235-ANGRBS15400
    Человек REG3A Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG11235-ANRRBS15400
    Человек REG3A Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11235-CFRBS13340
    Человек REG3A Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11235-CHRBS13340
    Человек REG3A Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11235-CMRBS13340
    Человек REG3A Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11235-CYRBS13340
    Человек REG3A Gene cDNA clone plasmidHG11235-MRBS5130
    Человек REG3A Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11235-NFRBS13340
    Человек REG3A Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11235-NHRBS13340
    Человек REG3A Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11235-NMRBS13340
    Человек REG3A Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11235-NYRBS13340
    Человек REG3A Джин ORF экспрессии кДНК клона плазмидыHG11235-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    Regenerating islet-derived protein 3-alpha, also known as Regenerating islet-derived protein III-alpha, REG-3-alpha, REG3A, and HIP, is secreted protein which contains one C-type lectin domain. REG3A is constitutively expressed in intestine, and is a pancreatic secretory protein that may be involved in cell proliferation or differentiation. It is overexpressed during the acute phase of pancreatitis and in some patients with chronic pancreatitis. REG3A and REG1A proteins are both involved in liver and pancreatic regeneration and proliferation. REG3A is also a stress protein involved in the control of bacterial proliferation. REG3A is down-regulated in most primary human gastric cancer cells, and might be useful in the diagnosis of gastric cancer. Additionally, REG3A is a target of beta-catenin signaling in Huh7 hepatoma cells. The REG1A and REG3A are downstream targets of the Wnt pathway during liver tumorigenesis.

    Ссылки
  • Cavard C, et al. (2006) Overexpression of regenerating islet-derived 1 alpha and 3 alpha genes in human primary liver tumors with beta-catenin mutations. Oncogene. 25(4): 599-608.
  • Choi B, et al. (2007) Downregulation of regenerating islet-derived 3 alpha (REG3A) in primary human gastric adenocarcinomas. Exp Mol Med. 39(6): 796-804.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».