Быстрый заказ

Человек REG1A Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human REG1A Информация о продукте «Клон cDNA»
Размер кДНК:501bp
Описание кДНК:Full length Clone DNA of Homo sapiens regenerating islet-derived 1 alpha with N terminal Flag tag.
Синоним гена:P19, PSP, PTP, REG, ICRF, PSPS, PSPS1, MGC12447, REG1A
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек REG1A Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Человек REG1A Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11234-ACGRBS15396
Человек REG1A Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11234-ACRRBS15396
Человек REG1A Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11234-CFRBS13343
Человек REG1A Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11234-CHRBS13343
Человек REG1A Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11234-CMRBS13343
Человек REG1A Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11234-CYRBS13343
Человек REG1A Джин клон кДНК в вектор клонированияHG11234-MRBS5132
Человек REG1A Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11234-NFRBS13343
Человек REG1A Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11234-NHRBS13343
Человек REG1A Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11234-NMRBS13343
Человек REG1A Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11234-NYRBS13343
Человек REG1A Джин ORF экспрессии кДНК клона плазмидыHG11234-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Regenerating (reg) gene encodes protein that has been involved in pancreatic lithogenesis and the regeneration of islet cells and therefore the abnormality of reg genes could be associated with fibrocalculous pancreatopathy. REG I has been shown to be crucial for induction of ductal epithelial cells to differentiate into some cells. Lithostathine-1-alpha, also known as Pancreatic stone protein, Pancreatic thread protein, Regenerating islet-derived protein 1-alpha, REG1A, REG-1-alpha, and PSPS, is highly expressed in fetal and infant brains. REG1A contains one C-type lectin domain and is a known growth factor affecting pancreatic islet beta cells. REG1A may act as an inhibitor of spontaneous calcium carbonate precipitation. It may also be associated with neuronal sprouting in brain, and with brain and pancreas regeneration. REG1A has been reported to be expressed in human cancers, and it may be positively correlated with patient's prognosis. REG3A and REG1A proteins are both involved in liver and pancreatic regeneration and proliferation. High levels of REG1A expression by tumor cells are an independent predictor of a poor prognosis in patients with non-small cell lung cancer (NSCLC).

  • Boonyasrisawat W, et al. (2002) Analysis of the reg1alpha and reg1beta gene transcripts in patients with fibrocalculous pancreatopathy. Southeast Asian J Trop Med Public Health. 33(2): 365-72.
  • Tezel E, et al. (2004) REG I as a marker for human pancreatic acinoductular cells. Hepatogastroenterology. 51(55): 91-6.
  • Geng J, et al. (2009) REG1A predicts recurrence in stage Ta/T1 bladder cancer. Eur J Surg Oncol. 35(8): 852-7.
  • Size / Price
    Каталог: HG11234-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.