Быстрый заказ

Человек RBPJ Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек RBPJ Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_005349.2
    Размер кДНК:1503bp
    Описание кДНК:Full length Clone DNA of Homo sapiens recombination signal binding protein for immunoglobulin kappa J region with N terminal Myc tag.
    Синоним гена:SUH, csl, CBF1, KBF2, RBP-J, RBPJK, IGKJRB, RBPSUH, IGKJRB1, MGC61669, RBPJ
    Виды:Human
    переносчик:pCMV3-N-Myc
    Plasmid:
    Участок рестрикции:
    Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with RBPJ qPCR primers for gene expression analysis, HP101735 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Человек RBPJ Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
    Человек RBPJ Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13113-ACGRBS16760
    Человек RBPJ Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13113-ACRRBS16760
    Человек RBPJ Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG13113-ANGRBS16760
    Человек RBPJ Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG13113-ANRRBS16760
    Человек RBPJ Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13113-CFRBS14710
    Человек RBPJ Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13113-CHRBS14710
    Человек RBPJ Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13113-CMRBS14710
    Человек RBPJ Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13113-CYRBS14710
    Человек RBPJ Джин клон кДНК в вектор клонированияHG13113-GRBS5130
    Человек RBPJ Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13113-NFRBS14710
    Человек RBPJ Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13113-NHRBS14710
    Человек RBPJ Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13113-NMRBS14710
    Человек RBPJ Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13113-NYRBS14710
    Человек RBPJ Джин ORF экспрессии кДНК клона плазмидыHG13113-UTRBS14710
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG13113-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».