After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек RBP1 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human RBP1 Информация о продукте «Клон cDNA»
Размер кДНК:408bp
Описание кДНК:Full length Clone DNA of Homo sapiens retinol binding protein 1, cellular with N terminal HA tag.
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек RBP1 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Человек RBP1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15803-ACGRBS15400
Человек RBP1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15803-ACRRBS15400
Человек RBP1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15803-ANGRBS15400
Человек RBP1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15803-ANRRBS15400
Человек RBP1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15803-CFRBS13340
Человек RBP1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15803-CHRBS13340
Человек RBP1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15803-CMRBS13340
Человек RBP1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15803-CYRBS13340
Человек RBP1 Джин клон кДНК в вектор клонированияHG15803-GRBS5130
Человек RBP1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15803-NFRBS13340
Человек RBP1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15803-NHRBS13340
Человек RBP1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15803-NMRBS13340
Человек RBP1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15803-NYRBS13340
Человек RBP1 Джин ORF экспрессии кДНК клона плазмидыHG15803-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.