Быстрый заказ

Text Size:AAA

Человек RASSF5 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human RASSF5 Информация о продукте «Клон cDNA»
Размер кДНК:798bp
Описание кДНК:Full length Clone DNA of Homo sapiens Ras association (RalGDS/AF-6) domain family member 5 with C terminal His tag.
Синоним гена:RAPL, Maxp1, NORE1, NORE1A, NORE1B, RASSF3
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек RASSF5 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек RASSF5 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15161-ACGRBS15396
Человек RASSF5 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15161-ACRRBS15396
Человек RASSF5 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15161-ANGRBS15396
Человек RASSF5 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15161-ANRRBS15396
Человек RASSF5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15161-CFRBS13343
Человек RASSF5 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15161-CHRBS13343
Человек RASSF5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15161-CMRBS13343
Человек RASSF5 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15161-CYRBS13343
Человек RASSF5 Джин клон кДНК в вектор клонированияHG15161-GRBS5132
Человек RASSF5 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15161-NFRBS13343
Человек RASSF5 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15161-NHRBS13343
Человек RASSF5 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15161-NMRBS13343
Человек RASSF5 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15161-NYRBS13343
Человек RASSF5 Джин ORF экспрессии кДНК клона плазмидыHG15161-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15161-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.