After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Human RASSF5 ORF mammalian expression plasmid, C-HA tag

ПаспортОбзорыСвязанные продуктыПротоколы
Human RASSF5 Информация о продукте «Клон cDNA»
Размер кДНК:798bp
Описание кДНК:Full length Clone DNA of Homo sapiens Ras association (RalGDS/AF-6) domain family member 5 with C terminal HA tag.
Синоним гена:RAPL, Maxp1, NORE1, NORE1A, NORE1B, RASSF3
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Size / Price
Каталог: HG15161-CY
Цена по прейскуранту:   (Save )
Цена:      [How to order]
Наличие2-3 weeksИнструкции по доставке
      Недавно просмотренные товары
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.