After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек RASGRF1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human RASGRF1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC040275
Размер кДНК:3546bp
Описание кДНК:Full length Clone DNA of Homo sapiens Ras protein-specific guanine nucleotide-releasing factor 1 with C terminal Flag tag.
Синоним гена:GNRP, GRF1, CDC25, GRF55, CDC25L, H-GRF55, PP13187, ras-GRF1
Виды:Human
переносчик:pCMV3-C-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек RASGRF1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Человек RASGRF1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13939-ACGRBS25660
Человек RASGRF1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13939-ACRRBS25660
Человек RASGRF1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG13939-ANGRBS25660
Человек RASGRF1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG13939-ANRRBS25660
Человек RASGRF1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13939-CFRBS23610
Человек RASGRF1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13939-CHRBS23610
Человек RASGRF1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13939-CMRBS23610
Человек RASGRF1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13939-CYRBS23610
Человек RASGRF1 Джин клон кДНК в вектор клонированияHG13939-GRBS5130
Человек RASGRF1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13939-NFRBS23610
Человек RASGRF1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13939-NHRBS23610
Человек RASGRF1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13939-NMRBS23610
Человек RASGRF1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13939-NYRBS23610
Человек RASGRF1 Джин ORF экспрессии кДНК клона плазмидыHG13939-UTRBS23610
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG13939-CF
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».