Быстрый заказ

Text Size:AAA

Человек RAMP3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human RAMP3 Информация о продукте «Клон cDNA»
Размер кДНК:447bp
Описание кДНК:Full length Clone DNA of Homo sapiens receptor (G protein-coupled) activity modifying protein 3 with N terminal Myc tag.
Синоним гена:RAMP3
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек RAMP3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек RAMP3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13744-ACGRBS15400
Человек RAMP3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13744-ACRRBS15400
Человек RAMP3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13744-CFRBS13340
Человек RAMP3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13744-CHRBS13340
Человек RAMP3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13744-CMRBS13340
Человек RAMP3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13744-CYRBS13340
Человек RAMP3 Джин клон кДНК в вектор клонированияHG13744-GRBS5130
Человек RAMP3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13744-NFRBS13340
Человек RAMP3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13744-NHRBS13340
Человек RAMP3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13744-NMRBS13340
Человек RAMP3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13744-NYRBS13340
Человек RAMP3 Джин ORF экспрессии кДНК клона плазмидыHG13744-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

RAMP3 belongs to the RAMP family. Members of this family are single-transmembrane-domain proteins, called receptor (calcitonin) activity modifying proteins (RAMPs). RAMPs have a wide biological distribution; high concentrations are found in the brain, lung, liver, heart and spleen with lower expression levels present in the testes, gastrointestinal tract and thyroid. RAMPs are type I transmembrane proteins with an extracellular N terminus and a cytoplasmic C terminus. They are required to transport calcitonin-receptor-like receptor (CRLR) to the plasma membrane. CRLR, a receptor with seven transmembrane domains, can function as either a calcitonin gene-related peptide (CGRP) receptor or an adrenomedullin receptor, depending on which members of the RAMP family are expressed. In the presence of RAMP3 protein, CRLR functions as an adrenomedullin receptor.

  • Stelzl U, et al. (2005) A human protein-protein interaction network: a resource for annotating the proteome. Cell. 122(6):957-68.
  • Scherer SW, et al. (2003) Human chromosome 7: DNA sequence and biology. Science. 300(5620):767-72.
  • Kuwasako K, et al. (2004) Characterization of the human calcitonin gene-related peptide receptor subtypes associated with receptor activity-modifying proteins. Mol Pharmacol. 65(1):207-13.
  • Size / Price
    Каталог: HG13744-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.