After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек RAMP1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human RAMP1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC000548
Размер кДНК:447bp
Описание кДНК:Full length Clone DNA of Homo sapiens receptor (G protein-coupled) activity modifying pr.
Синоним гена:RAMP1
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек RAMP1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек RAMP1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13298-ACGRBS15400
Человек RAMP1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13298-ACRRBS15400
Человек RAMP1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13298-CFRBS13340
Человек RAMP1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13298-CHRBS13340
Человек RAMP1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13298-CMRBS13340
Человек RAMP1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13298-CYRBS13340
Человек RAMP1 Джин клон кДНК в вектор клонированияHG13298-GRBS5130
Человек RAMP1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13298-NFRBS13340
Человек RAMP1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13298-NHRBS13340
Человек RAMP1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13298-NMRBS13340
Человек RAMP1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13298-NYRBS13340
Человек RAMP1 Джин ORF экспрессии кДНК клона плазмидыHG13298-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG13298-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».