After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек RALBP1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human RALBP1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_006788.3
Размер кДНК:1968bp
Описание кДНК:Full length Clone DNA of Homo sapiens ralA binding protein 1.
Синоним гена:RIP1, RLIP1, RLIP76, RALBP1
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек RALBP1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек RALBP1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11178-ACGRBS16764
Человек RALBP1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11178-ACRRBS16760
Человек RALBP1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11178-CFRBS14710
Человек RALBP1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11178-CHRBS14711
Человек RALBP1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11178-CMRBS14711
Человек RALBP1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11178-CYRBS14711
Человек RALBP1 Джин клон кДНК в вектор клонированияHG11178-MRBS5130
Человек RALBP1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11178-M-FRBS14710
Человек RALBP1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11178-NFRBS14711
Человек RALBP1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11178-NHRBS14710
Человек RALBP1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11178-NMRBS14710
Человек RALBP1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11178-NYRBS14711
Человек RALBP1 Джин ORF экспрессии кДНК клона плазмидыHG11178-UTRBS14711
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG11178-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».