After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Human RAC2 ORF mammalian expression plasmid, N-HA tag

ПаспортОбзорыСвязанные продуктыПротоколы
Human RAC2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_002872.3
Размер кДНК:579bp
Описание кДНК:Full length Clone DNA of Homo sapiens ras-related C3 botulinum toxin substrate 2 (rho family, small GTP binding protein Rac2) with N terminal HA tag.
Синоним гена:Gx, EN-7, HSPC022, RAC2
Виды:Human
переносчик:pCMV3-N-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Фон

Ras-related C3 botulinum toxin substrate 2 (Rac2) is a small G-protein belonging to the Ras subfamily of the GTPase family. Rac2 acts as an "on / off" switch for signal transduction cascades and motilities. When GDP is attached to the small G-protein, the enzyme is inactivated. Release of the GDP and replace of the GTP cativate the GTPasee. Rac2 remains active until the GTP is hydrolyzed to GDP. Rac2 is a hematopoietic-specific Rho family GTPase implicated as an important constituent of the NADPH oxidase complex and shares 92% amino acid identity with the ubiquitously expressed Rac1. The small G-protein Rac2 regulates the rearrangements of actin and membrane necessary for Fcy receptor-mediated phagocytosis by macrophages. Activated Rac2 binds to the p21-binding domain of PAK1 and this binding provided a basis for microscopic methods to localize activation of these G proteins inside cells.

Ссылки
  • Adam D, et al. (2003) Cdc42, Rac1, and Rac2 Display Distinct Patterns of Activation during Phagocytosis.Mol Biol Cell. 15 (8 ): 3509-19.
  • Walmsley MJ, et al. (2003) Critical Roles for Rac1 and Rac2 GTPases in B Cell Development and Signaling. Science. 302 (5644): 459-62.
  • Holland M, et al. (2011) RAC2, AEP, and ICAM1 expression are associated with CNS disease in a mouse model of pre-B childhood acute lymphoblastic leukemia. Blood. 118 (3): 638-49.
  • Size / Price
    Каталог: HG12100-NY
    Цена по прейскуранту:   (Save )
    Цена:      [How to order]
    Наличие
     Инструкции по доставке
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».