After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек RAB6B Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human RAB6B Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC002510
Размер кДНК:627bp
Описание кДНК:Full length Clone DNA of Homo sapiens RAB6B, member RAS oncogene family.
Синоним гена:RAB6B
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек RAB6B Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек RAB6B Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14229-ACGRBS15396
Человек RAB6B Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14229-ACRRBS15396
Человек RAB6B Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14229-ANGRBS15396
Человек RAB6B Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14229-ANRRBS15396
Человек RAB6B Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14229-CFRBS13343
Человек RAB6B Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14229-CHRBS13343
Человек RAB6B Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14229-CMRBS13343
Человек RAB6B Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14229-CYRBS13343
Человек RAB6B Джин клон кДНК в вектор клонированияHG14229-GRBS5132
Человек RAB6B Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14229-NFRBS13343
Человек RAB6B Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14229-NHRBS13343
Человек RAB6B Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14229-NMRBS13343
Человек RAB6B Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14229-NYRBS13343
Человек RAB6B Джин ORF экспрессии кДНК клона плазмидыHG14229-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG14229-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».