Быстрый заказ

Человек RAB5A Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

  • Human RAB5A ORF mammalian expression plasmid, C-His tag
ПаспортОбзорыСвязанные продуктыПротоколы
Человек RAB5A Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC001267
Размер кДНК:648bp
Описание кДНК:Full length Clone DNA of Homo sapiens RAB5A, member RAS oncogene family with C terminal His tag.
Синоним гена:RAB5, RAB5A
Виды:Human
переносчик:pCMV3-C-His
Plasmid:pCMV3-Rab5-His
Участок рестрикции:KpnI + XbaI (6kb + 0.69kb)
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with RAB5A qPCR primers for gene expression analysis, HP102669 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек RAB5A Gene Plasmid Map
Human RAB5A ORF mammalian expression plasmid, C-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек RAB5A Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек RAB5A Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14013-ACGRBS15400
Человек RAB5A Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14013-ACRRBS15400
Человек RAB5A Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14013-ANGRBS15400
Человек RAB5A Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14013-ANRRBS15400
Человек RAB5A Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14013-CFRBS13340
Человек RAB5A Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14013-CHRBS13340
Человек RAB5A Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14013-CMRBS13340
Человек RAB5A Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14013-CYRBS13340
Человек RAB5A Джин клон кДНК в вектор клонированияHG14013-GRBS5130
Человек RAB5A Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14013-NFRBS13340
Человек RAB5A Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14013-NHRBS13340
Человек RAB5A Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14013-NMRBS13340
Человек RAB5A Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14013-NYRBS13340
Человек RAB5A Джин ORF экспрессии кДНК клона плазмидыHG14013-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG14013-CH
Цена по прейскуранту: 
Цена:      (You Save: )

Datasheet & Documentation

All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».