Быстрый заказ

Text Size:AAA

Человек RAB3C Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human RAB3C Информация о продукте «Клон cDNA»
Размер кДНК:684bp
Описание кДНК:Full length Clone DNA of Homo sapiens RAB3C, member RAS oncogene family with N terminal Myc tag.
Синоним гена:RAB3C
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек RAB3C Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек RAB3C Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15456-ACGRBS15396
Человек RAB3C Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15456-ACRRBS15396
Человек RAB3C Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15456-CFRBS13343
Человек RAB3C Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15456-CHRBS13343
Человек RAB3C Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15456-CMRBS13343
Человек RAB3C Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15456-CYRBS13343
Человек RAB3C Джин клон кДНК в вектор клонированияHG15456-GRBS5132
Человек RAB3C Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15456-NFRBS13343
Человек RAB3C Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15456-NHRBS13343
Человек RAB3C Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15456-NMRBS13343
Человек RAB3C Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15456-NYRBS13343
Человек RAB3C Джин ORF экспрессии кДНК клона плазмидыHG15456-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15456-NM
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.