After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек RAB39B Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human RAB39B Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC009714
Размер кДНК:642bp
Описание кДНК:Full length Clone DNA of Homo sapiens RAB39B, member RAS oncogene family with C terminal His tag.
Синоним гена:MRX72, RAB39B
Виды:Human
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек RAB39B Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек RAB39B Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14011-ACGRBS15400
Человек RAB39B Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14011-ACRRBS15400
Человек RAB39B Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14011-ANGRBS15400
Человек RAB39B Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14011-ANRRBS15400
Человек RAB39B Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14011-CFRBS13340
Человек RAB39B Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14011-CHRBS13340
Человек RAB39B Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14011-CMRBS13340
Человек RAB39B Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14011-CYRBS13340
Человек RAB39B Джин клон кДНК в вектор клонированияHG14011-GRBS5130
Человек RAB39B Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14011-NFRBS13340
Человек RAB39B Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14011-NHRBS13340
Человек RAB39B Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14011-NMRBS13340
Человек RAB39B Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14011-NYRBS13340
Человек RAB39B Джин ORF экспрессии кДНК клона плазмидыHG14011-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG14011-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».