RAB39A cDNA ORF Clone, Human, C-HA tag

Price:
Size:
Number:

RAB39A cDNA ORF Clone, Human, C-HA tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
654 bp
Description
Full length Clone DNA of Human RAB39A, member RAS oncogene family with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

RAB39A cDNA ORF Clone, Human, C-HA tag: Alternative Names

RAB39 cDNA ORF Clone, Human

RAB39A Background Information

RAB39A, a member of the RAS oncogene family. RAB39A is a Rab small GTPase that localizes at distinct subcellular compartments and regulates intracellular membrane trafficking pathways in vertebrate cells. RAB39A interacts with various molecules and modulates vesicular trafficking that regulates multiple biological pathways such as neuronal differentiation and/or autophagy.
Full Name
RAB39A, member RAS oncogene family
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait