Rab2 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Price:
Size:
Number:

Rab2 cDNA ORF Clone, Human, C-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
639 bp
Description
Full length Clone DNA of Human RAB2A, member RAS oncogene family with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Rab2 cDNA ORF Clone, Human, C-DDK (Flag®) tag: Alternative Names

LHX cDNA ORF Clone, Human; RAB2 cDNA ORF Clone, Human

Rab2 Background Information

RAB2A, a protein essential for ER-to-Golgi transport, is critical in promoting proteolytic activity and 3D invasiveness of breast cancer (BC) cell lines.RAB2A is amplified and elevated in human BC and is a powerful and independent predictor of disease recurrence in BC patients. Thus, RAB2A is a novel trafficking determinant essential for regulation of a mesenchymal invasive program of BC dissemination.At the cellular levels, RAB2A controls both canonical polarized Golgi-to-Plasma membrane trafficking of the junctional protein E-cadherin, and post-endocytic trafficking of the membrane-bound metalloprotease, MT1-MMP.
Full Name
RAB2A, member RAS oncogene family
Add to Cart Successfully Add to Cart Failed