After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек RAB25 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human RAB25 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC009831
Размер кДНК:642bp
Описание кДНК:Full length Clone DNA of Homo sapiens RAB25, member RAS oncogene family.
Синоним гена:CATX-8, RAB11C, RAB25
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек RAB25 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек RAB25 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14236-ACGRBS15400
Человек RAB25 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14236-ACRRBS15400
Человек RAB25 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14236-ANGRBS15400
Человек RAB25 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14236-ANRRBS15400
Человек RAB25 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14236-CFRBS13340
Человек RAB25 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14236-CHRBS13340
Человек RAB25 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14236-CMRBS13340
Человек RAB25 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14236-CYRBS13340
Человек RAB25 Джин клон кДНК в вектор клонированияHG14236-GRBS5130
Человек RAB25 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14236-NFRBS13340
Человек RAB25 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14236-NHRBS13340
Человек RAB25 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14236-NMRBS13340
Человек RAB25 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14236-NYRBS13340
Человек RAB25 Джин ORF экспрессии кДНК клона плазмидыHG14236-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG14236-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».