After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек RAB20 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human RAB20 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC026025
Размер кДНК:705bp
Описание кДНК:Full length Clone DNA of Homo sapiens RAB20, member RAS oncogene family DNA.
Синоним гена:RAB20
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек RAB20 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек RAB20 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15240-ACGRBS15400
Человек RAB20 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15240-ACRRBS15400
Человек RAB20 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15240-ANGRBS15400
Человек RAB20 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15240-ANRRBS15400
Человек RAB20 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15240-CFRBS13340
Человек RAB20 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15240-CHRBS13340
Человек RAB20 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15240-CMRBS13340
Человек RAB20 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15240-CYRBS13340
Человек RAB20 Джин клон кДНК в вектор клонированияHG15240-GRBS5130
Человек RAB20 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15240-NFRBS13340
Человек RAB20 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15240-NHRBS13340
Человек RAB20 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15240-NMRBS13340
Человек RAB20 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15240-NYRBS13340
Человек RAB20 Джин ORF экспрессии кДНК клона плазмидыHG15240-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15240-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».