After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек RAB11A Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human RAB11A Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC013348
Размер кДНК:651bp
Описание кДНК:Full length Clone DNA of Homo sapiens RAB11A, member RAS oncogene family with C terminal His tag.
Синоним гена:YL8, RAB11A
Виды:Human
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек RAB11A Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек RAB11A Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14014-ACGRBS15400
Человек RAB11A Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14014-ACRRBS15400
Человек RAB11A Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14014-ANGRBS15400
Человек RAB11A Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14014-ANRRBS15400
Человек RAB11A Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14014-CFRBS13340
Человек RAB11A Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14014-CHRBS13340
Человек RAB11A Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14014-CMRBS13340
Человек RAB11A Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14014-CYRBS13340
Человек RAB11A Джин клон кДНК в вектор клонированияHG14014-GRBS5130
Человек RAB11A Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14014-NFRBS13340
Человек RAB11A Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14014-NHRBS13340
Человек RAB11A Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14014-NMRBS13340
Человек RAB11A Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14014-NYRBS13340
Человек RAB11A Джин ORF экспрессии кДНК клона плазмидыHG14014-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG14014-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».