After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек Glutaminyl cyclase / QPCT Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human QPCT Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC047756
Размер кДНК:1086bp
Описание кДНК:Full length Clone DNA of Homo sapiens glutaminyl-peptide cyclotransferase with N terminal Myc tag.
Синоним гена:GCT, QC, sQC, QPCT
Виды:Human
переносчик:pCMV3-SP-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек Glutaminyl cyclase / QPCT Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек Glutaminyl cyclase / QPCT Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13752-ACGRBS15400
Человек Glutaminyl cyclase / QPCT Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13752-ACRRBS15400
Человек Glutaminyl cyclase / QPCT Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13752-CFRBS13340
Человек Glutaminyl cyclase / QPCT Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13752-CHRBS13340
Человек Glutaminyl cyclase / QPCT Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13752-CMRBS13340
Человек Glutaminyl cyclase / QPCT Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13752-CYRBS13340
Человек Glutaminyl cyclase / QPCT Джин клон кДНК в вектор клонированияHG13752-GRBS5130
Человек Glutaminyl cyclase / QPCT Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13752-NFRBS13340
Человек Glutaminyl cyclase / QPCT Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13752-NHRBS13340
Человек Glutaminyl cyclase / QPCT Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13752-NMRBS13340
Человек Glutaminyl cyclase / QPCT Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13752-NYRBS13340
Человек Glutaminyl cyclase / QPCT Джин ORF экспрессии кДНК клона плазмидыHG13752-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Glutaminyl cyclase, also known as QPCT, can promote the N-terminal cyclization reaction of N-terminal pyroglutamate(pGlu). The pGlu formation from its glutaminyl precursor is required in the maturation of numerous bioactive peptides, while the aberrant formation of pGlu may be related to several pathological processes, such as osteoporosis and amyloidotic diseases. Glutaminyl cyclase's structure reveals an alpha/beta scaffold akin to that of two-zinc exopeptidases but with several insertions and deletions, particularly in the active-site region. Glutaminyl cyclase's amino acid sequence of this enzyme is 86% identical to that of bovine glutaminyl cyclase. It is responsible for the presence of pyroglutamyl residues in many neuroendocrine peptides.

Ссылки
  • Busby WH, et al. (1987) An enzyme(s) that converts glutaminyl-peptides into pyroglutamyl-peptides. Presence in pituitary, brain, adrenal medulla, and lymphocytes. J Biol Chem. 262(18):8532-6.
  • Bateman RC, et al. (2001) Evidence for essential histidines in human pituitary glutaminyl cyclase. Biochemistry. 40(37):11246-50.
  • Schilling S, et al. (2002) Heterologous expression and characterization of human glutaminyl cyclase: evidence for a disulfide bond with importance for catalytic activity. Biochemistry. 41 (35):10849-57.
  • Size / Price
    Каталог: HG13752-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».