Быстрый заказ

Человек Glutaminyl cyclase / QPCT Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек QPCT Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:BC047756
    Размер кДНК:1086bp
    Описание кДНК:Full length Clone DNA of Homo sapiens glutaminyl-peptide cyclotransferase with N terminal Myc tag.
    Синоним гена:GCT, QC, sQC, QPCT
    Виды:Human
    переносчик:pCMV3-SP-N-Myc
    Plasmid:
    Участок рестрикции:
    Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with QPCT qPCR primers for gene expression analysis, HP102429 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Человек Glutaminyl cyclase / QPCT Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
    Человек Glutaminyl cyclase / QPCT Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13752-ACGRBS15400
    Человек Glutaminyl cyclase / QPCT Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13752-ACRRBS15400
    Человек Glutaminyl cyclase / QPCT Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13752-CFRBS13340
    Человек Glutaminyl cyclase / QPCT Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13752-CHRBS13340
    Человек Glutaminyl cyclase / QPCT Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13752-CMRBS13340
    Человек Glutaminyl cyclase / QPCT Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13752-CYRBS13340
    Человек Glutaminyl cyclase / QPCT Джин клон кДНК в вектор клонированияHG13752-GRBS5130
    Человек Glutaminyl cyclase / QPCT Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13752-NFRBS13340
    Человек Glutaminyl cyclase / QPCT Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13752-NHRBS13340
    Человек Glutaminyl cyclase / QPCT Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13752-NMRBS13340
    Человек Glutaminyl cyclase / QPCT Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13752-NYRBS13340
    Человек Glutaminyl cyclase / QPCT Джин ORF экспрессии кДНК клона плазмидыHG13752-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    Glutaminyl cyclase, also known as QPCT, can promote the N-terminal cyclization reaction of N-terminal pyroglutamate(pGlu). The pGlu formation from its glutaminyl precursor is required in the maturation of numerous bioactive peptides, while the aberrant formation of pGlu may be related to several pathological processes, such as osteoporosis and amyloidotic diseases. Glutaminyl cyclase's structure reveals an alpha/beta scaffold akin to that of two-zinc exopeptidases but with several insertions and deletions, particularly in the active-site region. Glutaminyl cyclase's amino acid sequence of this enzyme is 86% identical to that of bovine glutaminyl cyclase. It is responsible for the presence of pyroglutamyl residues in many neuroendocrine peptides.

    Ссылки
  • Busby WH, et al. (1987) An enzyme(s) that converts glutaminyl-peptides into pyroglutamyl-peptides. Presence in pituitary, brain, adrenal medulla, and lymphocytes. J Biol Chem. 262(18):8532-6.
  • Bateman RC, et al. (2001) Evidence for essential histidines in human pituitary glutaminyl cyclase. Biochemistry. 40(37):11246-50.
  • Schilling S, et al. (2002) Heterologous expression and characterization of human glutaminyl cyclase: evidence for a disulfide bond with importance for catalytic activity. Biochemistry. 41 (35):10849-57.
  • Size / Price
    Каталог: HG13752-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».