Pleiotrophin cDNA ORF Clone, Human, untagged

Cat: HG10288-UT

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All Pleiotrophin Reagents

CRO Services

Product recommended


All Pleiotrophin Reagents

Pleiotrophin cDNA ORF Clone, Human, untagged General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
498 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human pleiotrophin.

Plasmid

Promoter
Enhanced CMV promoter
Restriction Sites
HindIII + XbaI (6.1kb + 0.5kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Pleiotrophin cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Pleiotrophin cDNA ORF Clone, Human, untagged Validated Images

Cynomolgus CD19/B4/CVID3 Gene Plasmid Map 5624

Pleiotrophin cDNA ORF Clone, Human, untagged Alternative Names

HARP cDNA ORF Clone, Human;HBGF8 cDNA ORF Clone, Human;HBNF cDNA ORF Clone, Human;NEGF1 cDNA ORF Clone, Human

Pleiotrophin Background Information

HB-GAM belongs to the pleiotrophin family. During embryonic and early postnatal development, HB-GAM is expressed in the central and peripheral nervous system and also in several non-neural tissues, notably lung, kidney, gut and bone. While in the adult central nervous system, it is expressed in an activity-dependent manner in the hippocampus where it can suppress long term potentiation induction. HB-GAM has a low expression in other areas of the adult brain, but it can be induced by ischemic insults, or targeted neuronal damaged in the entorhinal cortex or in the substantia nigra pars compacta. It is structurally related to midkine and retinoic acid induced heparin-binding protein and has a high affinity for heparin. HB-GAM binds anaplastic lymphoma kinase (ALK) which induces MAPK pathway activation, an important step in the anti-apoptotic signaling of PTN and regulation of cell proliferation. It also functions as a secreted growth factor and induces neurite outgrowth and which is mitogenic for fibroblasts, epithelial, and endothelial cells.

Full Name
pleiotrophin
References
  • Vanderwinden JM, et al. (1992) Cellular distribution of the new growth factor pleiotrophin (HB-GAM) mRNA in developing and adult rat tissues. Anat Embryol. 186(4):387-406.
  • Lauri SE, et al. (1996) Activity-induced enhancement of HB-GAM expression in rat hippocampal slices. Neuroreport. 7(10):1670-4.
  • Pavlov I, et al. (2002) Role of heparin-binding growth-associated molecule (HB-GAM) in hippocampal LTP and spatial learning revealed by studies on overexpressing and knockout mice. Mol Cell Neurosci. 20(2):330-42.
  • Pleiotrophin cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Pleiotrophin cDNA ORF Clone in Cloning Vector, Rat RG81121-U
    Pleiotrophin cDNA ORF Clone, Rat, untagged RG81121-UT
    Pleiotrophin Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81121-ACGLN
    Pleiotrophin cDNA ORF Clone, Rat, C-GFPSpark® tag RG81121-ACG
    Pleiotrophin cDNA ORF Clone, Rat, C-OFPSpark® tag RG81121-ACR
    Pleiotrophin cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81121-CF
    Pleiotrophin cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81121-NF
    Pleiotrophin cDNA ORF Clone, Rat, C-His tag RG81121-CH
    Pleiotrophin cDNA ORF Clone, Rat, N-His tag RG81121-NH
    Pleiotrophin cDNA ORF Clone, Rat, C-HA tag RG81121-CY
    Pleiotrophin cDNA ORF Clone, Rat, N-HA tag RG81121-NY
    Pleiotrophin cDNA ORF Clone, Rat, C-Myc tag RG81121-CM
    Pleiotrophin cDNA ORF Clone, Rat, N-Myc tag RG81121-NM
    Pleiotrophin qPCR Primer Pairs, Rat RP301078

    Pleiotrophin cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Pleiotrophin cDNA ORF Clone in Cloning Vector, Mouse MG51000-G
    Pleiotrophin cDNA ORF Clone, Mouse, untagged MG51000-UT
    Pleiotrophin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51000-ACGLN
    Pleiotrophin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51000-ACG
    Pleiotrophin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51000-ACR
    Pleiotrophin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51000-CF
    Pleiotrophin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51000-NF
    Pleiotrophin cDNA ORF Clone, Mouse, C-His tag MG51000-CH
    Pleiotrophin cDNA ORF Clone, Mouse, N-His tag MG51000-NH
    Pleiotrophin cDNA ORF Clone, Mouse, C-HA tag MG51000-CY
    Pleiotrophin cDNA ORF Clone, Mouse, N-HA tag MG51000-NY
    Pleiotrophin cDNA ORF Clone, Mouse, C-Myc tag MG51000-CM
    Pleiotrophin cDNA ORF Clone, Mouse, N-Myc tag MG51000-NM
    Pleiotrophin qPCR Primer Pairs, Mouse MP200965

    Pleiotrophin cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Pleiotrophin cDNA ORF Clone in Cloning Vector, Human HG10288-M
    Pleiotrophin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10288-ACGLN
    Pleiotrophin cDNA ORF Clone, Human, C-GFPSpark® tag HG10288-ACG
    Pleiotrophin cDNA ORF Clone, Human, C-OFPSpark® tag HG10288-ACR
    Pleiotrophin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10288-CF
    Pleiotrophin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10288-NF
    Pleiotrophin cDNA ORF Clone, Human, C-His tag HG10288-CH
    Pleiotrophin cDNA ORF Clone, Human, N-His tag HG10288-NH
    Pleiotrophin cDNA ORF Clone, Human, C-HA tag HG10288-CY
    Pleiotrophin cDNA ORF Clone, Human, N-HA tag HG10288-NY
    Pleiotrophin cDNA ORF Clone, Human, C-Myc tag HG10288-CM
    Pleiotrophin cDNA ORF Clone, Human, N-Myc tag HG10288-NM
    Pleiotrophin qPCR Primer Pairs, Human HP100333
    info info
    添加购物车成功! 添加购物车失败!