Быстрый заказ

Text Size:AAA

Человек PZP Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human PZP Информация о продукте «Клон cDNA»
Размер кДНК:3807bp
Описание кДНК:Full length Clone DNA of Homo sapiens pregnancy-zone protein with N terminal His tag.
Синоним гена:CPAMD6
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек PZP Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек PZP Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15980-ACGRBS25660
Человек PZP Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15980-ACRRBS25660
Человек PZP Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15980-CFRBS23610
Человек PZP Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15980-CHRBS23610
Человек PZP Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15980-CMRBS23610
Человек PZP Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15980-CYRBS23610
Человек PZP Джин клон кДНК в вектор клонированияHG15980-GRBS5130
Человек PZP Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15980-NFRBS23610
Человек PZP Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15980-NHRBS23610
Человек PZP Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15980-NMRBS23610
Человек PZP Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15980-NYRBS23610
Человек PZP Джин ORF экспрессии кДНК клона плазмидыHG15980-UTRBS23610
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15980-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.