PXMP4 cDNA ORF Clone, Human, untagged

Price:
Size:
Number:

PXMP4 cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
639 bp
Description
Full length Clone DNA of Human peroxisomal membrane protein 4, 24kDA.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

PXMP4 cDNA ORF Clone, Human, untagged: Alternative Names

PMP24 cDNA ORF Clone, Human

PXMP4 Background Information

Full Name
peroxisomal membrane protein 4
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait