After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек PXMP4 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human PXMP4 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC001147
Размер кДНК:639bp
Описание кДНК:Full length Clone DNA of Homo sapiens peroxisomal membrane protein 4, 24kDA.
Синоним гена:RP4-553F4.4, PMP24, PXMP4
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек PXMP4 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек PXMP4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14232-ACGRBS15400
Человек PXMP4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14232-ACRRBS15400
Человек PXMP4 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14232-ANGRBS15400
Человек PXMP4 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14232-ANRRBS15400
Человек PXMP4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14232-CFRBS13340
Человек PXMP4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14232-CHRBS13340
Человек PXMP4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14232-CMRBS13340
Человек PXMP4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14232-CYRBS13340
Человек PXMP4 Джин клон кДНК в вектор клонированияHG14232-GRBS5130
Человек PXMP4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14232-NFRBS13340
Человек PXMP4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14232-NHRBS13340
Человек PXMP4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14232-NMRBS13340
Человек PXMP4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14232-NYRBS13340
Человек PXMP4 Джин ORF экспрессии кДНК клона плазмидыHG14232-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG14232-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».