Быстрый заказ

Человек PTPN2/TC-PTP transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

  • Human PTPN2 transcript variant 1 ORF mammalian expression plasmid, N-Flag tag
ПаспортОбзорыСвязанные продуктыПротоколы
Человек PTPN2 Информация о продукте «Клон cDNA»
Размер кДНК:1248bp
Описание кДНК:Full length Clone DNA of Homo sapiens protein tyrosine phosphatase, non-receptor type 2, transcript variant 1 with N terminal Flag tag.
Участок рестрикции:KpnI + NotI (6kb + 1.29kb)
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
( We provide with PTPN2 qPCR primers for gene expression analysis, HP100578 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек PTPN2 Gene Plasmid Map
Human PTPN2 transcript variant 1 ORF mammalian expression plasmid, N-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек PTPN2/TC-PTP transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Человек PTPN2/TC-PTP transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10570-ACGRBS15400
Человек PTPN2/TC-PTP transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10570-ACRRBS15400
Человек PTPN2/TC-PTP transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG10570-ANGRBS15400
Человек PTPN2/TC-PTP transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG10570-ANRRBS15400
Человек PTPN2/TC-PTP transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10570-CFRBS13340
Человек PTPN2/TC-PTP transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10570-CHRBS13340
Человек PTPN2/TC-PTP transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10570-CMRBS13340
Человек PTPN2/TC-PTP transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10570-CYRBS13340
Человек PTPN2/TC-PTP transcript variant 1 Джин клон кДНК в вектор клонированияHG10570-MRBS5130
Человек PTPN2/TC-PTP transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10570-NFRBS13340
Человек PTPN2/TC-PTP transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10570-NHRBS13340
Человек PTPN2/TC-PTP transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10570-NMRBS13340
Человек PTPN2/TC-PTP transcript variant 1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10570-NYRBS13340
Человек PTPN2/TC-PTP transcript variant 1 Джин ORF экспрессии кДНК клона плазмидыHG10570-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Tyrosine-protein phosphatase non-receptor type 2, also known as T-cell protein-tyrosine phosphatase, PTPN2 and PTPT, is a cytoplasm protein which belongs to the protein-tyrosine phosphatase family and Non-receptor class 1 subfamily. Members of the protein tyrosine phosphatase ( PTP ) family share a highly conserved catalytic motif, which is essential for the catalytic activity. TC-PTP / PTPN2 is a cytosolic tyrosine phosphatase that functions as a negative regulator of a variety of tyrosine kinases and other signaling proteins. The expression of TC-PTP / PTPN2 plays a role of tumor suppressor and may modulate response to treatment. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. Epidermal growth factor receptor and the adaptor protein Shc were reported to be substrates of this PTP, which suggested the roles in growth factor mediated cell signaling. TC-PTP / PTPN2 is an enzyme that is essential for the proper functioning of the immune system and that participates in the control of cell proliferation, and inflammation. TC-PTP / PTPN2 was identified as a negative regulator of NUP214-ABL1 kinase activity.

Size / Price
Каталог: HG10570-NF
Цена по прейскуранту: 
Цена:      (You Save: )

Datasheet & Documentation

Contact Us
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.