Быстрый заказ

Человек SHP2 / PTPN11 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек PTPN11 Информация о продукте «Клон cDNA»
    Размер кДНК:1383bp
    Описание кДНК:Full length Clone DNA of Homo sapiens protein tyrosine phosphatase, non-receptor type 11 with N terminal His tag.
    Синоним гена:CFC, NS1, SHP2, BPTP3, PTP2C, PTP-1D, SH-PTP2, SH-PTP3, PTPN11
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    ( We provide with PTPN11 qPCR primers for gene expression analysis, HP101919 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Человек SHP2 / PTPN11 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
    Человек SHP2 / PTPN11 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12318-ACGRBS15400
    Человек SHP2 / PTPN11 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12318-ACRRBS15400
    Человек SHP2 / PTPN11 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG12318-ANGRBS15400
    Человек SHP2 / PTPN11 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG12318-ANRRBS15400
    Человек SHP2 / PTPN11 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12318-CFRBS13340
    Человек SHP2 / PTPN11 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12318-CHRBS13340
    Человек SHP2 / PTPN11 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12318-CMRBS13340
    Человек SHP2 / PTPN11 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12318-CYRBS13340
    Человек SHP2 / PTPN11 Джин клон кДНК в вектор клонированияHG12318-GRBS5130
    Человек SHP2 / PTPN11 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12318-NFRBS13340
    Человек SHP2 / PTPN11 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12318-NHRBS13340
    Человек SHP2 / PTPN11 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12318-NMRBS13340
    Человек SHP2 / PTPN11 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12318-NYRBS13340
    Человек SHP2 / PTPN11 Джин ORF экспрессии кДНК клона плазмидыHG12318-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name

    SHP2, also known as PTPN11, belongs to the protein-tyrosine phosphatase(PTP) family, non-receptor class 2 subfamily. PTPs catalyze the removal of phosphate groups from tyrosine residues by the hydrolysis of phosphoric acid monoesters. They dephosphorylate EGFR, JAK2 and TYK2 kinases, promoting oncogenic transformation. SHP2 is widely expressed, with highest levels in heart, brain, and skeletal muscle. SHP2 acts downstream of various receptor and cytoplasmic protein tyrosine kinases to participate in the signal transduction from the cell surface to the nucleus. It also dephosphorylates ROCK2 at Tyr-722 resulting in stimulatation of its RhoA binding activity.

  • Ganju R K, et al. (2000) Beta-chemokine receptor CCR5 signals through SHP1, SHP2, and Syk. J Biol Chem. 275(23):17263-8.
  • Yin T, et al. (1997) Molecular characterization of specific interactions between SHP-2 phosphatase and JAK tyrosine kinases. J Biol Chem. 272(2):1032-7.
  • Kontaridis MI, et al. (2006) PTPN11 (Shp2) mutations in LEOPARD syndrome have dominant negative, not activating, effects. J Biol Chem. 281(10):6785-92.
  • Size / Price
    Каталог: HG12318-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.