After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек COX-2/PTGS2 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human PTGS2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_000963
Размер кДНК:1815bp
Описание кДНК:Full length Clone DNA of Homo sapiens prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase) with C terminal His tag.
Синоним гена:COX2
Виды:Human
переносчик:pCMV3-C-His
Plasmid:pCMV3-PTGS2-His
Участок рестрикции:KpnI + XbaI (6kb + 1.86kb)
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human PTGS2 Gene Plasmid Map
Human PTGS2 ORF mammalian expression plasmid, C-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек COX-2/PTGS2 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек COX-2/PTGS2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12036-ACGRBS16760
Человек COX-2/PTGS2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12036-ACRRBS16760
Человек COX-2/PTGS2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG12036-ANGRBS16760
Человек COX-2/PTGS2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG12036-ANRRBS16760
Человек COX-2/PTGS2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12036-CFRBS14710
Человек COX-2/PTGS2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12036-CHRBS14710
Человек COX-2/PTGS2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12036-CMRBS14710
Человек COX-2/PTGS2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12036-CYRBS14710
Человек COX-2/PTGS2 Джин клон кДНК в вектор клонированияHG12036-GRBS5130
Человек COX-2/PTGS2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12036-NFRBS14710
Человек COX-2/PTGS2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12036-NHRBS14710
Человек COX-2/PTGS2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12036-NMRBS14710
Человек COX-2/PTGS2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12036-NYRBS14710
Человек COX-2/PTGS2 Джин ORF экспрессии кДНК клона плазмидыHG12036-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

PTGS2, also known as COX-2, is s component of Prostaglandin-endoperoxide synthase (PTGS). PTGS, also known as cyclooxygenase, is the key enzyme in prostaglandin biosynthesis, and acts both as a dioxygenase and as a peroxidase. There are two isozymes of PTGS: a constitutive PTGS1 and an inducible PTGS2, which differ in their regulation of expression and tissue distribution. PTGS2 is over expressed in many cancers. The overexpression of PTGS2 along with increased angiogenesis and GLUT-1 expression is significantly associated with gallbladder carcinomas. Furthermore the product of COX-2, PGH2 is converted by prostaglandin E2 synthase into PGE2, which in turn can stimulate cancer progression. Consequently inhibiting COX-2 may have benefit in the prevention and treatment of these types of cancer. PTGS2 is regulated by specific stimulatory events, suggesting that it is responsible for the prostanoid biosynthesis involved in inflammation and mitogenesis. It mediates the formation of prostaglandins from arachidonate and may have a role as a major mediator of inflammation and/or a role for prostanoid signaling in activity-dependent plasticity.

Ссылки
  • Picot, et al. (1994) The X-ray crystal structure of the membrane protein prostaglandin H2 synthase-1. Nature. 367(6460):243-9.
  • Xie W, et al. (1991) Expression of a Mitogen-Responsive Gene Encoding Prostaglandin Synthase is Regulated by mRNA Splicing. Proceedings of the National Academy of Sciences. 88(7):2692-6.
  • Hla T, et al. (1992) Human Cyclooxygenase-2 cDNA. Proceedings of the National Academy of Sciences. 89(16):7384-8.
  • Size / Price
    Каталог: HG12036-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
    • Human PTGS2 ORF mammalian expression plasmid, C-His tag
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».