Быстрый заказ

Человек PSME2 / PA28b Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human PSME2 Информация о продукте «Клон cDNA»
Размер кДНК:720bp
Описание кДНК:Full length Clone DNA of Homo sapiens proteasome (prosome, macropain) activator subunit 2 (PA28 beta) with N terminal HA tag.
Синоним гена:PA28B, REGbeta, PA28beta
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек PSME2 / PA28b Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Человек PSME2 / PA28b Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14640-ACGRBS15400
Человек PSME2 / PA28b Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14640-ACRRBS15400
Человек PSME2 / PA28b Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14640-ANGRBS15400
Человек PSME2 / PA28b Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14640-ANRRBS15400
Человек PSME2 / PA28b Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14640-CFRBS13340
Человек PSME2 / PA28b Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14640-CHRBS13340
Человек PSME2 / PA28b Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14640-CMRBS13340
Человек PSME2 / PA28b Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14640-CYRBS13340
Человек PSME2 / PA28b Джин клон кДНК в вектор клонированияHG14640-GRBS5130
Человек PSME2 / PA28b Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14640-NFRBS13340
Человек PSME2 / PA28b Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14640-NHRBS13340
Человек PSME2 / PA28b Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14640-NMRBS13340
Человек PSME2 / PA28b Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14640-NYRBS13340
Человек PSME2 / PA28b Джин ORF экспрессии кДНК клона плазмидыHG14640-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

PSME2, also known as PA28b, is a subunit of proteasome. The 26S proteasome multicatalytic proteinase complex has a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. The immunoproteasome contains an alternate regulator, referred to as the 11S regulator or PA28, that replaces the 19S regulator. Three subunits (alpha, beta and gamma) of the 11S regulator have been identified. PSME2 gene encodes the beta subunit of the 11S regulator, one of the two 11S subunits that is induced by gamma-interferon. Three beta and three alpha subunits combine to form a heterohexameric ring.

  • Ahn K. et al., 1996, J Biol Chem. 271 (30): 18237-42.
  • Rual Jean-François. et al., 2005, Nature. 437 (7062): 1173-8.
  • Ahn JY. et al., 1995, FEBS Lett. 366 (1): 37-42.
  • Size / Price
    Каталог: HG14640-NY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.