PSMC4 cDNA ORF Clone, Human, untagged

Price:
Size:
Number:

PSMC4 cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1257 bp
Description
Full length Clone DNA of Human proteasome (prosome, macropain) 26S subunit, ATPase, 4.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

PSMC4 cDNA ORF Clone, Human, untagged: Alternative Names

MIP224 cDNA ORF Clone, Human; RPT3 cDNA ORF Clone, Human; S6 cDNA ORF Clone, Human; TBP-7 cDNA ORF Clone, Human; TBP7 cDNA ORF Clone, Human

PSMC4 Background Information

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait