Быстрый заказ

Text Size:AAA

Человек PSMA4 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human PSMA4 Информация о продукте «Клон cDNA»
Размер кДНК:786bp
Описание кДНК:Full length Clone DNA of Homo sapiens proteasome (prosome, macropain) subunit, alpha type, 4 with N terminal HA tag.
Синоним гена:HC9, PSC9, HsT17706
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек PSMA4 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Человек PSMA4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG16401-ACGRBS15396
Человек PSMA4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG16401-ACRRBS15396
Человек PSMA4 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG16401-ANGRBS15396
Человек PSMA4 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG16401-ANRRBS15396
Человек PSMA4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG16401-CFRBS13343
Человек PSMA4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG16401-CHRBS13343
Человек PSMA4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG16401-CMRBS13343
Человек PSMA4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG16401-CYRBS13343
Человек PSMA4 Джин клон кДНК в вектор клонированияHG16401-GRBS5132
Человек PSMA4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG16401-NFRBS13343
Человек PSMA4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG16401-NHRBS13343
Человек PSMA4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG16401-NMRBS13343
Человек PSMA4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG16401-NYRBS13343
Человек PSMA4 Джин ORF экспрессии кДНК клона плазмидыHG16401-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG16401-NY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.