After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек PSMA1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human PSMA1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_002786.3
Размер кДНК:792bp
Описание кДНК:Full length Clone DNA of Homo sapiens proteasome (prosome, macropain) subunit, alpha type, 1.
Синоним гена:NU, HC2, PROS30, HEL-S-275
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек PSMA1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек PSMA1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG16142-ACGRBS15400
Человек PSMA1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG16142-ACRRBS15400
Человек PSMA1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG16142-ANGRBS15400
Человек PSMA1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG16142-ANRRBS15400
Человек PSMA1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG16142-CFRBS13340
Человек PSMA1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG16142-CHRBS13340
Человек PSMA1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG16142-CMRBS13340
Человек PSMA1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG16142-CYRBS13340
Человек PSMA1 Джин клон кДНК в вектор клонированияHG16142-GRBS5130
Человек PSMA1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG16142-NFRBS13340
Человек PSMA1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG16142-NHRBS13340
Человек PSMA1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG16142-NMRBS13340
Человек PSMA1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG16142-NYRBS13340
Человек PSMA1 Джин ORF экспрессии кДНК клона плазмидыHG16142-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG16142-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».