Быстрый заказ

Человек Trypsin 2/PRSS2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек PRSS2 Информация о продукте «Клон cDNA»
    Размер кДНК:744bp
    Описание кДНК:Full length Clone DNA of Homo sapiens protease, serine, 2 (trypsin 2) with N terminal Myc tag.
    Синоним гена:TRY2, TRY8, TRYP2, MGC111183, MGC120174, PRSS2
    Участок рестрикции:
    Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Описание последовательности:
    ( We provide with PRSS2 qPCR primers for gene expression analysis, HP100718 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Человек Trypsin 2/PRSS2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
    Человек Trypsin 2/PRSS2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10813-ACGRBS15400
    Человек Trypsin 2/PRSS2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10813-ACRRBS15400
    Человек Trypsin 2/PRSS2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10813-CFRBS13340
    Человек Trypsin 2/PRSS2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10813-CHRBS13340
    Человек Trypsin 2/PRSS2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10813-CMRBS13340
    Человек Trypsin 2/PRSS2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10813-CYRBS13340
    Человек Trypsin 2/PRSS2 Джин клон кДНК в вектор клонированияHG10813-MRBS5130
    Человек Trypsin 2/PRSS2 Джин ORF экспрессии кДНК клона плазмидыHG10813-M-NRBS13340
    Человек Trypsin 2/PRSS2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10813-NFRBS13340
    Человек Trypsin 2/PRSS2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10813-NHRBS13340
    Человек Trypsin 2/PRSS2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10813-NMRBS13340
    Человек Trypsin 2/PRSS2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10813-NYRBS13340
    Человек Trypsin 2/PRSS2 Джин ORF экспрессии кДНК клона плазмидыHG10813-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name

    Trypsin-2, also known as Trypsin II, Anionic trypsinogen, Serine protease 2, PRSS2 and TRY2, is a secreted protein which belongs to the trypsin serine protease family including Trypsin, PRSS1, PRSS2 and PRSS3. It consists of a signal peptide (residues 1-15), a pro region (residues 16-23), and a proteolytically active mature chain (residues 24-247). PRSS2 contains one peptidase S1 domain. It is secreted into the duodenum, hydrolysing peptides into their smaller building blocks, which is necessary for the uptake of protein in the food. It is secreted by the pancreas in the form of inactive zymogen, trypsinogen and cleaved to its active form in the small intestine when the pancreas is stimulated by cholecystokinin through the common activation mechanism.

  • Rawlings, N.D. et al.,1994, Meth. Enzymol. 244: 19–61.
  • Noone, P.G. et al., 2001, Gastroenterology. 121 (6): 1310-9.
  • Leiros, H.K. et al., 2004, Protein Sci. 13 (4): 1056–70.
  • Rónai,Z. et al., 2009, Biochem J. 418 (1):155-61.
  • Size / Price
    Каталог: HG10813-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.