After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек Trypsin 2/PRSS2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human PRSS2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_002770.2
Размер кДНК:744bp
Описание кДНК:Full length Clone DNA of Homo sapiens protease, serine, 2 (trypsin 2) with N terminal Myc tag.
Синоним гена:TRY2, TRY8, TRYP2, MGC111183, MGC120174, PRSS2
Виды:Human
переносчик:pCMV3-SP-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек Trypsin 2/PRSS2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек Trypsin 2/PRSS2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10813-ACGRBS15400
Человек Trypsin 2/PRSS2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10813-ACRRBS15400
Человек Trypsin 2/PRSS2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10813-CFRBS13340
Человек Trypsin 2/PRSS2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10813-CHRBS13340
Человек Trypsin 2/PRSS2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10813-CMRBS13340
Человек Trypsin 2/PRSS2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10813-CYRBS13340
Человек Trypsin 2/PRSS2 Джин клон кДНК в вектор клонированияHG10813-MRBS5130
Человек Trypsin 2/PRSS2 Джин ORF экспрессии кДНК клона плазмидыHG10813-M-NRBS13340
Человек Trypsin 2/PRSS2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10813-NFRBS13340
Человек Trypsin 2/PRSS2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10813-NHRBS13340
Человек Trypsin 2/PRSS2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10813-NMRBS13340
Человек Trypsin 2/PRSS2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10813-NYRBS13340
Человек Trypsin 2/PRSS2 Джин ORF экспрессии кДНК клона плазмидыHG10813-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Mouse Trypsin-2, also known as Trypsin II, Anionic trypsinogen, Serine protease 2, PRSS2 and TRY2, is a secreted protein which belongs to the trypsin serine protease family including Trypsin, PRSS1, PRSS2 and PRSS3. It consists of a signal peptide (residues 1-15), a pro region (residues 16-23), and a proteolytically active mature chain (residues 24-247). PRSS2 contains one peptidase S1 domain. It is secreted into the duodenum, hydrolysing peptides into their smaller building blocks, which is necessary for the uptake of protein in the food. It is secreted by the pancreas in the form of inactive zymogen, trypsinogen and cleaved to its active form in the small intestine when the pancreas is stimulated by cholecystokinin through the common activation mechanism.

Ссылки
  • Rawlings, N.D. et al.,1994, Meth. Enzymol. 244: 19–61.
  • Noone, P.G. et al., 2001, Gastroenterology. 121 (6): 1310-9.
  • Leiros, H.K. et al., 2004, Protein Sci. 13 (4): 1056–70.
  • Rónai,Z. et al., 2009, Biochem J. 418 (1):155-61.
  • Size / Price
    Каталог: HG10813-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».