After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек Trypsin 1/PRSS1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human PRSS1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_002769.4
Размер кДНК:744bp
Описание кДНК:Full length Clone DNA of Homo sapiens protease, serine, 1 (trypsin 1) with N terminal Myc tag.
Синоним гена:TRP1, TRY1, TRY4, TRYP1, MGC120175, MGC149362, PRSS1
Виды:Human
переносчик:pCMV3-SP-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек Trypsin 1/PRSS1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек Trypsin 1/PRSS1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10816-ACGRBS15400
Человек Trypsin 1/PRSS1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10816-ACRRBS15400
Человек Trypsin 1/PRSS1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10816-CFRBS13340
Человек Trypsin 1/PRSS1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10816-CHRBS13340
Человек Trypsin 1/PRSS1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10816-CMRBS13340
Человек Trypsin 1/PRSS1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10816-CYRBS13340
Человек Trypsin 1/PRSS1 Джин клон кДНК в вектор клонированияHG10816-MRBS5130
Человек Trypsin 1/PRSS1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10816-M-FRBS13340
Человек Trypsin 1/PRSS1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10816-NFRBS13340
Человек Trypsin 1/PRSS1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10816-NHRBS13340
Человек Trypsin 1/PRSS1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10816-NMRBS13340
Человек Trypsin 1/PRSS1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10816-NYRBS13340
Человек Trypsin 1/PRSS1 Джин ORF экспрессии кДНК клона плазмидыHG10816-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG10816-NM
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».