Быстрый заказ

Text Size:AAA

Человек PRPF31 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human PRPF31 Информация о продукте «Клон cDNA»
Размер кДНК:1500bp
Описание кДНК:Full length Clone DNA of Homo sapiens PRP31 pre-mRNA processing factor 31 homolog (S. cerevisiae) with C terminal HA tag.
Синоним гена:RP11, PRP31, NY-BR-99
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек PRPF31 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Человек PRPF31 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15777-ACGRBS15400
Человек PRPF31 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15777-ACRRBS15400
Человек PRPF31 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15777-ANGRBS15400
Человек PRPF31 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15777-ANRRBS15400
Человек PRPF31 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15777-CFRBS13340
Человек PRPF31 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15777-CHRBS13340
Человек PRPF31 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15777-CMRBS13340
Человек PRPF31 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15777-CYRBS13340
Человек PRPF31 Джин клон кДНК в вектор клонированияHG15777-GRBS5130
Человек PRPF31 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15777-NFRBS13340
Человек PRPF31 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15777-NHRBS13340
Человек PRPF31 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15777-NMRBS13340
Человек PRPF31 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15777-NYRBS13340
Человек PRPF31 Джин ORF экспрессии кДНК клона плазмидыHG15777-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15777-CY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.