Быстрый заказ

Человек PROS1/Protein S Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human PROS1 Информация о продукте «Клон cDNA»
Размер кДНК:2031bp
Описание кДНК:Full length Clone DNA of Homo sapiens protein S (alpha) with C terminal Myc tag.
Синоним гена:PSA, PROS, PS21, PS22, PS23, PS24, PS25, PROS1
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек PROS1/Protein S Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Человек PROS1/Protein S Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12179-ACGRBS16760
Человек PROS1/Protein S Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12179-ACRRBS16760
Человек PROS1/Protein S Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12179-CFRBS14710
Человек PROS1/Protein S Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12179-CHRBS14710
Человек PROS1/Protein S Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12179-CMRBS14710
Человек PROS1/Protein S Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12179-CYRBS14710
Человек PROS1/Protein S Джин клон кДНК в вектор клонированияHG12179-GRBS5130
Человек PROS1/Protein S Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12179-NFRBS14710
Человек PROS1/Protein S Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12179-NHRBS14710
Человек PROS1/Protein S Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12179-NMRBS14710
Человек PROS1/Protein S Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12179-NYRBS14710
Человек PROS1/Protein S Джин ORF экспрессии кДНК клона плазмидыHG12179-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name

PROS1, also known as protein S, is a vitamin K-dependent plasma protein that functions as a cofactor for the anticoagulant protease, activated protein C (APC) to inhibit blood coagulation. PROS1 has two isoforms: a free, functionally active form and an inactive form complexed with C4b-binding protein. Besides its anticoagulant function, PROS1 also acts as an agonist for the tyrosine kinase receptors Tyro3, Axl, and Mer. The endothelium expresses Tyro3, Axl, and Mer and produces protein S. The interaction of protein S with endothelial cells and particularly its effects on angiogenesis have not yet been analyzed.

  • Beauchamp NJ. et al., 2004, Br J Haematol. 125 (5): 647-54.
  • García de Frutos P. et al., 2007, Thromb Haemost. 98 (3): 543-56.
  • Rezende SM. et al., 2004, Blood. 103 (4): 1192-201.
  • Size / Price
    Каталог: HG12179-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.