After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек PROK2 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human PROK2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC098162
Размер кДНК:390bp
Описание кДНК:Full length Clone DNA of Homo sapiens prokineticin 2 with N terminal HA tag.
Синоним гена:BV8, HH4, PK2, KAL4, MIT1
Виды:Human
переносчик:pCMV3-SP-N-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек PROK2 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Человек PROK2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15802-ACGRBS15400
Человек PROK2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15802-ACRRBS15400
Человек PROK2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15802-CFRBS13340
Человек PROK2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15802-CHRBS13340
Человек PROK2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15802-CMRBS13340
Человек PROK2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15802-CYRBS13340
Человек PROK2 Джин клон кДНК в вектор клонированияHG15802-GRBS5130
Человек PROK2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15802-NFRBS13340
Человек PROK2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15802-NHRBS13340
Человек PROK2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15802-NMRBS13340
Человек PROK2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15802-NYRBS13340
Человек PROK2 Джин ORF экспрессии кДНК клона плазмидыHG15802-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15802-NY
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».